Abstract
SLC10A4 belongs to the sodium bile acid cotransporter family, but has no transport activity for bile acids. We performed multiple amino acid alignments and examined the relationships between the SLC10 proteins. The extracellular N-terminus of SLC10A4 was predicted to be relatively longer at the amino acid level than those of SLC10A1, SLC10A2 and SLC10A6. We examined the relationship between the N-terminus and transport activity of SLC10A4. Rat Slc10a4 is predominantly expressed in rat cholinergic neurons; therefore, TE671 cells expressing the acetylcholine receptor and acetylcholinesterase were used. After thrombin treatment, western blotting and immunofluorescence staining demonstrated that the N-terminus of SLC10A4 might be cleaved. Substrates were added to the cells, and their uptake was quantified by liquid chromatography tandem mass spectrometry. Lithocholic acid (LCA) and taurocholic acid (TCA) uptake and cell death effects of LCA were increased by thrombin treatment. After RNA interference treatment for SLC10A4, bile acid uptake was also quantified. In consequence, increases in the LCA and TCA uptake did not occur. Therefore, SLC10A4 may have low activity but becomes activated by proteases, including thrombin, following cleavage. We have demonstrated that SLC10A4 appears to be a protease-activated transporter and transports bile acids.
SLC10A4 belongs to the sodium bile acid cotransporter family. Despite its close phylogenetic relationship with SLC10A1, Slc10a4 showed no transport activity for the SLC10A1 substrates taurocholate, estrone-3-sulphate (E3S), dehydroepiandrosterone sulphate and pregnenolone sulphate when expressed in CHO cells, HEK293 cells or Xenopus laevis oocytes (1, 2). Slc10a4 is the rat counterpart of the human orphan carrier SLC10A4, which has recently been reported to be highly expressed in human brain and small intestine (1). Similarly, in the rat and mouse, Slc10a4 mRNA expression is highly expressed in the brain, but very low levels are detected in other tissues (1). Moreover, expression of the Slc10a4 protein was detected in cholinergic neurons, cholinergic areas of the brain and the gut myenteric plexus (1). The actual function of SLC10A4, however, still requires further elucidation.
Bile acids, which are synthesized from cholesterol and the major solute in bile, have neutralizing effect, emulsifying effect and excretion effect in the gastrointestinal tract and are involved in absorption such as food, in excretion of cholesterol and in xenobiotic excretion of drugs and toxins. Recently, bile acids are shown to be involved in apoptotic and cell signal transduction pathways via specific bile transport proteins located on the plasma membrane of liver and intestinal epithelia (1, 2). Recently, Mano et al. (3) reported the existence of several bile acids in the brain. However, the function of brain bile acids remains unclear.
The human medulloblastoma cell line TE671 has been investigated and found to have several neuron-like properties, including the presence of functional nicotinic acetylcholine receptors and the cholinergic marker protein acetylcholinesterase (4, 5). We tested whether SLC10A4 is expressed in TE671 cells, as SLC10A4 has been shown to be predominantly expressed in cholinergic neurons. Following western blotting analysis, we demonstrated that SLC10A4 is expressed in TE671 cells. Therefore, we used TE671 cells to elucidate the function of SLC10A4.
To analyse the function of SLC10A4, we performed multiple amino acid alignments and examined the relationship between the SLC10 proteins. The deduced amino acid sequences were aligned using the EBI ClustalW algorithm (6). The alignment of the SLC10 family members revealed that the extracellular N-terminus of SLC10A4 was relatively longer than other members of the family. Therefore, we examined the relationship between the N-terminus and transport activity.
Materials and Methods
Chemicals
Thrombin, taurocholic acid (TCA), lithocholic acid (LCA) and estrone 3-sulfate (E3S) were purchased from Sigma-Aldrich (St Louis, MO, USA). Chenodeoxycholic acid (CDCA) and deoxycholic acid (DCA) were purchased from Tokyo Chemical Industry Co., Ltd (Tokyo, Japan). D4-LCA, d4-CDCA and d4-DCA were purchased from CDN Isotopes (Pointe-Claire, Quebec, Canada). D4-TCA was purchased from Medical Isotopes (Pelham, AL, USA). 13C6-E3S was purchased from Cambridge Isotope Laboratories (Andover, MA, USA).
Cell culture
Human medulloblastoma cell line TE671 cells were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% (v/v) fetal calf serum, 4 mM l-glutamine, 50 U/ml penicillin and 50 µg/ml streptomycin. For western blotting, transport experiments and the methylthiazol tetrazolium (MTT) assay, cells were seeded at a density of 4 × 105 cells/ml. For immunofluorescence staining, the cells were seeded at a density of 8 × 104 cells/ml. SLC10A4 Stealth Select RNAi™ siRNA (100 nM, Invitrogen, Carlsbad, CA, USA) was used for RNA interference (RNAi). Target sequences of the SLC10A4 Stealth Select RNAi™ siRNAs were 1: CATCATGACCATCTCCTCCACGCTT, 2: TGGAAACAGGTAGTCAGAATGTGCA and 3: CCGCAATTCATAGGAAGCATGTACA. Treatment occurred following TE671 cells being plated at a density of 4 × 105 cells/ml 1 h before transfection. Stealth™ RNAi Negative Control Medium GC Duplex (10 nM, Invitrogen) was used as a negative control. Stealth RNAi was mixed with Lipofectamine™ RNAiMAX and added to the cells. After 72 h, the cells were plated at a density of 4 × 105 cells/ml. To examine transport and western blotting, cells were used at 24 h.
Immunoblot analysis
Cells were washed with phosphate-buffered saline (PBS), lysed in ice-cold RIPA buffer containing 150 mM NaCl, 25 mM Tris–HCl (pH 7.8), 5 mM EDTA, 1% (v/v) Nonidet P-40, 0.5% (w/v) sodium DCA, 0.1% (w/v) SDS and protease inhibitor cocktail (Sigma-Aldrich). Cell lysates were homogenized using ultrasonication. Total cell lysate proteins (30 µg/lane) were separated by SDS–PAGE (10% (w/v)). SLC10A4 was detected using a rabbit polyclonal anti-SLC10A4 antibody (Sigma-Aldrich). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was detected using a rabbit monoclonal anti-GAPDH antibody (Cell Signaling Technology, Beverly, MA, USA). The antibody was raised against amino acids 324–436 of the SLC10A4 protein sequence (anti-SLC10A4 C-terminus antibody). The primary antibodies were diluted 1 : 1,000, and chemiluminescence detection (SuperSignal West Pico Chemiluminescent Substrate; Thermo Scientific) was performed using horseradish peroxidase-labelled mouse anti-rabbit IgG (Cell Signaling Technology), diluted 1 : 2,000 as a secondary antibody.
Immunofluorescence staining
Immunofluorescence staining was measured using monolayer cultures grown on eight-well glass slides. The cells were plated at a density of 4 × 104 cells/well. After 24 h, the cells were washed twice with Krebs–Henseleit buffer (118 mM NaCl, 23.8 mM NaHCO3, 4.83 mM KCl, 0.96 mM KH2PO4, 1.20 mM MgSO4, 12.5 mM HEPES, 5.0 mM glucose and 1.53 mM CaCl2, adjusted to pH 7.4), and treated with 1 U/200 µl of thrombin dissolved in Krebs–Henseleit buffer for 3 h. After washing, cells were fixed with 4% (w/v) paraformaldehyde in phosphate buffer for 30 min at room temperature, and again washed with PBS three times. Subsequently, TE671 cells were permeabilized for 15 min in PBT (0.1% (v/v) Triton X-100 in PBS) and washed with PBS three times. Non-specific binding sites were blocked with 1% (w/v) bovine serum albumin (BSA; Sigma-Aldrich) in PBS for 90 min at room temperature. Non-permeabilized cells were not treated with PBT. After washing (three times), cells were incubated with primary antibodies, rabbit anti-amino acids 324–436 of the SLC10A4 protein sequence (anti-SLC10A4 C-terminus antibody, 1 : 200 dilution; Sigma-Aldrich), and rabbit anti-amino acids 2–51 of the SLC10A4 protein sequence (anti-SLC10A4 N-terminus antibody, 1 : 200 dilution; Sigma-Aldrich) in blocking solution overnight at 4°C. The next day, the cells were washed three times with PBS and incubated with the fluorophore-labelled secondary antibodies: Alexa Fluor® 546 Goat Anti-rabbit IgG (1 : 500 dilution, Molecular Probe Invitrogen) in blocking solution for 60 min at room temperature. Nuclear stain was performed with Hoechst 33258 solution (1 : 2,000 dilution, Dojindo, Japan). After a final washing step with PBS, cells were mounted onto slides with Fluorescence Mounting Medium (Dako, Denmark). Immunofluorescence was viewed using a Zeiss confocal laser-scanning microscope (LSM700) with 40× water-emergent objective.
Transport studies
Cellular uptake of LCA, TCA, CDCA, DCA and E3S was measured using monolayer cultures grown on 24-well plates. Cells were plated at a density of 2 × 105 cells/well. To examine transport at 24 h, cells were washed twice with Krebs–Henseleit buffer, and treated with 1 U/200 µl of thrombin dissolved in Krebs–Henseleit buffer for 3 h. After washing and preincubation in Krebs–Henseleit buffer, uptake was initiated by addition of substrates to the medium. At the designated times, the uptake was terminated by aspiration of the uptake buffer and addition of ice-cold Krebs–Henseleit buffer. After two washes with ice-cold Krebs–Henseleit buffer, the intracellular substrates were extracted with 500 µl of ethanol, and stable isotope-labelled bile acids and 13C6-E3S were added as internal standards into all wells. Bile acid extraction was performed as described previously (7–9). Solutions were collected and stored at −80°C until analysis. Protein content was determined via the BCA method using aliquots of the lysed cells and BSA as the standard.
Quantification of bile acid uptake by TE671 cells
Quantification of bile acids and E3S was determined as described previously (10, 11). Samples were evaporated after ethanol extraction in vacuo at room temperature. The residues were dissolved in 40 µl of mobile phase, and 10 µl of each solution was subjected to liquid chromatography tandem mass spectrometry (LC/MS/MS) analysis after filtration. The LC/MS/MS analysis was performed using a TSQ Quantum Vantage (Thermo Fisher Scientific, San Jose, CA, USA) equipped with an electrospray ionization probe for TCA and E3S quantification. Quantification of LCA, CDCA and DCA was performed with an atmospheric pressure chemical ionization probe. The reversed-phase column used in this study was a Capcell Pak C18 MGII Column (5 µm, 150 mm × 1.5 mm i.d.; Shiseido, Tokyo, Japan) maintained at 40°C. The mobile phase for TCA quantification was formic acid/water/acetonitrile (0.1 : 60 : 40, v/v/v). The mobile phase for LCA quantification was 20 mM ammonium acetate in water/acetonitrile (40 : 60, v/v). The mobile phase for E3S, CDCA and DCA quantification was 20 mM ammonium acetate in water/acetonitrile (65 : 35, v/v). These mobile phases were used at a flow rate of 200 µl/min and delivered by an Ultimate 3000 Pump (Dionex Thermo Fisher Scientific). The mass spectrometric conditions for these substrates were as follows: Spray voltages (V) were −2500 and −2500 for TCA and E3S, respectively. The discharge current (µA) was −4 for LCA, CDCA and DCA. S lens voltages (V) were 236, 143, 190, 154 and 154 for TCA, E3S, LCA, CDCA and DCA, respectively. S lens voltages (V) for IS were 236, 159, 194, 157 and 157 for TCA, E3S, LCA, CDCA and DCA, respectively. Collision energies (V) were 19, 33, 19, 26 and 26 for TCA, E3S, LCA, CDCA and DCA, respectively. Collision energies (V) for IS were 26, 39, 20, 28 and 28 for TCA, E3S, LCA, CDCA and DCA, respectively. Selected reaction monitoring (SRM) was 514.3 > 514.3, 349.1 > 269.2, 375.3 > 375.3, 391.3 > 391.3 and 391.3 > 391.3 for TCA, E3S, LCA, CDCA and DCA, respectively. SRM for IS was 518.3 > 518.3, 355.1 > 275.2, 379.3 > 379.3, 395.3 > 395.3 and 395.3 > 395.3 for TCA, E3S, LCA, CDCA and DCA, respectively.
Analytical methods
Evaluation of cell viability using the MTT assay
Cell viability was determined as described previously (12). Cells were plated at a density of 4 × 104 cells/well in 96-well plates. After 24 h, cells were washed twice with Krebs–Henseleit buffer, and treated with 0.2 U/40 µl of thrombin dissolved in Krebs–Henseleit buffer for 3 h. After washing, different amounts of LCA dissolved in ethanol were added to the medium to create final LCA concentrations ranging from 10 to 300 µM. Control cell cultures were treated with ethanol (0.1% (v/v)). At 48 h after the addition of LCA, 20 μl of 5 mg/ml MTT dissolved in Krebs–Henseleit buffer was added to each well. After 4 h, the medium was removed and 100 μl of dimethyl sulfoxide was added to each well. Finally, the optical densities were measured at a wavelength of 570 nm and the growth inhibitory rate was calculated. Experiments were carried out in triplicate. Significance of differences from the control values were determined by ANOVA followed by Ryan’s method.
Results
To analyse the function of SLC10A4, we performed multiple amino acid alignments and examined the relationship between the SLC10 proteins. The deduced amino acid sequences were aligned using the EBI ClustalW algorithm (Fig. 1) (6). The alignment of the SLC10 family members revealed that the extracellular N-terminus of SLC10A4 was relatively longer compared with other subtypes in this family.
Multiple alignment of human, rat and mouse SLC10A1, SLC10A2, SLC10A6 and SLC10A4. The sequences shown are before transmembrane domain I (TMDI). The thrombin site is indicated by the arrows.
The relative expression levels of SLC10A4 in lysates of TE671 cells were investigated using western blot analyses (Fig. 2). The anti-SLC10A4 antibody recognized an ∼90-kDa protein and a 35-kDa protein. SLC10A4 was expressed in control TE671 cells and was observed as a 90-kDa band. Therefore, this cell line was used in this study. After thrombin treatment, levels of the 90-kDa protein decreased, whereas the 35-kDa protein increased. The 90-kDa protein may be the glycosylated form of SLC10A4 (1, 2). The 35-kDa protein was the C-terminus of SLC10A4 cleaved by thrombin, as the anti-SLC10A4 antibody was raised against amino acid residues 324–436 of the SLC10A4 protein sequence.
Western blot and immunofluorescence stain analyses. Control represents vehicle-treated cells. Thrombin represents thrombin-treated cells. A 90-kDa protein was detected, which was thought to be glycosylated SLC10A4. The 35-kDa band is predicted to be amino acids 88–437 of SLC10A4 after cleavage by thrombin (A). Distribution of SLC10A4 N-terminal and C-terminal (B–E). Cells were treated with ‘thrombin (+)’ or vehicle ‘thrombin (−)’ for 3 h. Subsequently, cells were fixed with 4% (w/v) paraformaldehyde with or without permeabilization (0.1% (v/v) triton-X), then stained using anti-SLC10A4 N-terminal (B) and anti-SLC10A4 C-terminal (D) antibodies. SLC10A4 expression on the plasma membrane decreased following thrombin treatment ((B); indicated by arrows). Scale bar indicates 20 µM. Quantification of fluorescence intensities are shown in (C) and (E). Fluorescent intensities per cell area for SLC10A4 N-terminal and SLC10A4 C-terminal are shown. Measurement for the area was carried out with NIH ImageJ software. Values represent the mean ± SEM; n = 4. ***P < 0.001 compared with ‘thrombin (−)’ in SLC10A4 N-terminal.
Immunofluorescence staining demonstrated that SLC10A4 was expressed on the plasma membrane of TE671 cells under membrane non-permeabilizing conditions. Localization of the SLC10A4 at plasma membranes was judged by the appearance of the plasma membrane ring pattern. The staining pattern for SLC10A4 was similar to that for acetylcholine receptors on the plasma membrane of TE671 cells (13). We thus demonstrated that SLC10A4 was expressed on the plasma membrane of TE671 cells. Anti-N-terminus and anti-C-terminus SLC10A4 sequences were used as primary antibodies. SLC10A4 was also expressed in the cytoplasm because the antibodies reached cytoplasmic epitopes under membrane permeabilizing conditions. The extracellular N-terminus of SLC10A4 was truncated by thrombin because immunoreactivity of the anti-N-terminus SLC10A4 antibody decreased on plasma membranes (Fig. 2). However, some SLC10A4 may not be cleaved by thrombin because immunoreactivity with the polyclonal anti-N-terminus SLC10A4 antibody did not completely disappear under our conditions. However, the non-specific reactivity of the polyclonal antibody was obvious.
LCA and TCA uptake were increased by thrombin pretreatment. Thrombin-enhanced transport was determined by subtracting the transport velocity in control cells from that in thrombin-treated cells. The obtained half-saturation concentration (Km) and maximum uptake rate (Vmax) of LCA during thrombin-enhanced transport were 1,300 nM and 490 pmol/mg protein/30 s, respectively. In the case of TCA, Km and Vmax were 520 nM and 1.2 pmol/mg protein/30 s, respectively. CDCA, DCA and E3S uptake were not increased by thrombin pretreatment (Fig. 3).
Transport analyses. LCA uptake (A–D). Thrombin indicates uptake by thrombin-treated cells. Control indicates uptake by vehicle-treated cells. LCA concentration was between 100 and 1,000 nM (A). Thrombin-enhanced transport was determined by subtracting the mean value of transport velocity in control cells from that in thrombin-treated cells. Non-linear regression analysis was performed and the value fitted to the Michaelis–Menten equation. Km = 1,300 nM, Vmax = 490 pmol/mg protein/30 s (B). Time course of uptake of LCA by thrombin-treated cells and vehicle-treated cells. LCA concentration was 300 nM (C). Thrombin-enhanced transport was determined by subtracting the mean value of transport velocity in control cells from that in thrombin-treated cells (D). TCA uptake (E, F). Thrombin indicates uptake by thrombin-treated cells. Control indicates uptake by vehicle-treated cells. TCA concentration was between 100 and 1,000 nM (E). Thrombin-enhanced transport was determined by subtracting the mean value of transport velocity in control cells from that in thrombin-treated cells. Non-linear regression analysis was performed and the value fitted to the Michaelis–Menten equation. Km = 520 nM, Vmax = 1.2 pmol/mg protein/30 s (F). CDCA uptake (G). DCA uptake (H). E3S uptake (I). Values represent the mean ± SD; n = 3 or 4.
Three Stealth RNAi SLC10A4 siRNAs were used for the SLC10A4 knockdown experiment (Fig. 4). TE671 cells treated with Stealth RNAi SLC10A4 siRNA were used for immunoblotting and transport studies. We investigated the effect of SLC10A4 on the enhancement of transport activity after thrombin pretreatment. There was no enhancement of transport activity after thrombin pretreatment in SLC10A4 knockdown cells. Although there was no significant enhancement of transport activity, there was a trend towards enhancement of transport activity in SLC10A4 knockdown cells following thrombin pretreatment. Next, a mix of three Stealth RNAi SLC10A4 siRNAs was used for SLC10A4 knockdown experiments (Fig. 5). After RNAi treatment for SLC10A4, no increase in LCA and TCA uptake was observed. Western blotting analysis revealed that the level of SLC10A4 expression was decreased by RNAi treatment.
SLC10A4 knockdown experiments. Stealth RNAi SLC10A4 siRNA was used at 100 nM. Stealth™ RNAi Negative Control was used at 10 nM. Western blot analysis demonstrates that the SLC10A4 protein level of the Stealth™ RNAi Negative Control treated cells was equal to that of non-treated cells, and decreased in SLC10A4 Stealth Select RNAi™ siRNA treated cells (A). Transport analyses: LCA concentration was 300 nM (B). 90-kDa is indicated by the arrows. All samples were not treated by thrombin. Values represent the mean ± SD; n = 3 or 4. NS indicates non-significant.
Effects of a mix of three Stealth RNAi SLC10A4 siRNAs on TE671 cells. Western blot analysis demonstrated that the SLC10A4 protein level of the Stealth™ RNAi Negative Control treated cells (centre) was equal to that of non-treated cells (left), and that of the SLC10A4 Stealth Select RNAi™ siRNA treated cells (right) was decreased. 90-kDa is indicated by the arrows. All samples were not treated by thrombin. (A). Transport analyses: LCA uptake (B–D). Non-treated indicates uptake by the RNAi non-treated cells (B). Negative control indicates uptake by the Stealth™ RNAi Negative Control treated cells (C). RNAi SLC10A4 indicates uptake by the SLC10A4 Stealth Select RNAi™ siRNA treated cells (D). TCA uptake (E–G). Non-treated indicates uptake by the RNAi non-treated cells (E). Negative control indicates uptake by the Stealth™ RNAi Negative Control treated cells (F). RNAi SLC10A4 indicates uptake by the SLC10A4 Stealth Select RNAi™ siRNA treated cells (G). Each point represents the mean of three or four experiments. Diamonds: control cells; circles: RNAi-treated cells. Values represent the mean ± SEM; n = 3 or 4.
Cell viability was determined using the MTT assay (Fig. 6). LCA alone caused cell death at concentrations of 10–300 µM. LCA-induced cell death was enhanced by thrombin treatment at all concentrations of LCA.
Cell viability assays. The relative susceptibilities of thrombin-treated TE671 cells to LCA were examined by the MTT assay. The relative viabilities are shown for LCA-treated cells relative to vehicle-treated control cells. The cells were treated with LCA or ethanol (vehicle for LCA) for 48 h. Open columns: control cells; grey columns: thrombin-treated cells. Each column represents the mean ± SD of three experiments. The significance of differences from the control values was determined by ANOVA followed by Ryan’s method. ***Significantly different from the control (P < 0.005).
Discussion
Thrombin pretreatment enhanced the cell death effects of LCA on TE671 cells. The effects of LCA were observed after uptake into the cells. Uptake of LCA was demonstrated, with a Km value of 1,300 nM. We examined whether other bile acids and E3S as substrates of bile acid transporters (the OATP family, OAT family, SLC10A1, SLC10A2 and SLC10A6) were transported into the cells. TCA uptake was demonstrated, with a Km value of 520 nM. The Km values for TCA in our study were lower than the previous Km values of TCA for BSEP, MRP3, NTCP, ASBT, OATP1A2, OATP1B1, OATP1B3, OATP2B1 and OATP4A1 (14–25). CDCA, DCA and E3S uptake were not increased after thrombin pretreatment. The transport in this study exhibited substrate specificity. By contrast, western blot analysis revealed that the 90-kDa SLC10A4 was cleaved to 35 kDa after thrombin treatment. The native form of the SLC10A4 protein is predicted to be 46.5 kDa. The 90-kDa protein may be the glycosylated form of SLC10A4. The 35-kDa protein may be the C-terminus of SLC10A4 cleaved by thrombin, because the anti-SLC10A4 antibody was raised against amino acid residues 324–436 of the SLC10A4 protein sequence. In rat Slc10a4, the N-terminus is localized extracellularly, whereas the C-terminus is localized intracellularly (1). Thrombin applied in the medium may have cleaved the extracellular portion of SLC10A4 in this study. Since the recognition sequence of thrombin was predicted to be Arg-Pro and the molecular weight of amino acids 88-437 of SLC10A4 is mathematically 33 kDa, the 35-kDa protein may comprise amino acids 88–437 of SLC10A4.
After RNAi treatment for SLC10A4 expressed on TE671 cells, no increase in LCA and TCA uptake by thrombin treatment was observed. Therefore, SLC10A4 may have low activity, but become activated following cleavage by proteases, including thrombin. We have demonstrated that SLC10A4 is a protease-activated transporter. The predicted transport mechanism via SLC10A4 is shown in Fig. 7. However, these substrates may be bound to SLC10A4 cleaved by thrombin as we could not demonstrate that these substrates showed intracellular uptake. This should be examined in the future. Figure 4B was inconsistent with data of Fig. 3A and B. We assume as follow. Figure 3A and B represents experiments using TE671 cells from different passage numbers. Thus, basal levels in Fig. 3A and B may be inconsistent. In this study, we used TE671 cells from passage numbers between 10 and 20. By contrast, RT–PCR of bile acid transporters and GAPDH used TE671 cells from passage numbers 11 and 17. Therefore, mRNA levels of transporters and GAPDH are altered. We think that these inconsistent data were caused by alteration of expression levels of bile acid transporters and that the difference between data in Figs 3 and 4 is due to the passage number used in each experiment.
LCA possesses apoptotic effects, with LCA-induced apoptosis carried out by intracellular caspase-8 (26). Therefore, facilitation of LCA uptake into TE671 cells treated with thrombin may induce apoptotic effects. The Km value of LCA is 1.3 µM. The value is significantly low. We assume that thrombin cleaves the N-terminus of SLC10A4 after intracerebral hemorrhage. This cleavage brings about LCA-dependent apoptosis of neuronal cells in the lesion, thus inhibiting the survival of dysfunctional neuronal cells. TE671 cells, found to have several neuron-like properties, were used in studies of cognitive function and neuromuscular junctions, as these cells express the acetylcholine receptor and the cholinergic marker protein, acetylcholinesterase (4, 5, 27, 28). Therefore, we believe that these cells can be used in neuronal cell models of post-intracerebral hemorrhage, as thrombin is activated by hemorrhage. Previously, Mano et al. (3) reported the existence of several bile acids in the brain, indicating a possible role for these acids in neuronal cells. The novel observations concerning a role of SLC10A4 in LCA-induced neuronal cell death in thrombin-treated cells may have implications for future treatment of intracerebral hemorrhage, as expression of the Slc10a4 protein has been highly detected in cholinergic neurons (1). However, Slc10a4 activity needs to be further investigated in animal models of intracerebral hemorrhage before this function can be attributed to this transporter. Intracerebral hemorrhage is carried out by autologous whole blood or thrombin infusion into brain (29–33). Therefore, we will attempt to perform animal experiments to determine whether activation of the thrombin pathway cleaves SLC10A4 in the brain during brain hemorrhage carried out by autologous whole blood or thrombin infusion into brain.
Acknowledgements
We greatly thank Professor Junken Aoki (Graduate School of Pharmaceutical Sciences, Tohoku University Division of Molecular and Cellular Biochemistry) for the donation of the instrument for this study. This research was supported by JSPS KAKENHI Grant Number 20390044.
Conflict of Interest
None declared.
Abbreviations
- CDCA
chenodeoxycholic acid
- DCA
deoxycholic acid
- EHC
enterohepatic circulation
- E3S
estrone-3-sulphate
- GAPDH
glyceraldehyde-3-phosphate dehydrogenase
- LC/MS/MS
liquid chromatography tandem mass spectrometry
- LCA
lithocholic acid
- MTT
methylthiazol tetrazolium
- RNAi
PBS, phosphate-buffered saline
- RNA interference; SRM
selected reaction monitoring
- TCA
taurocholic acid
